T7 RNA Polymerase, Fermentas (Thermo Scientific)

EP0112 EP0111
101673-186EA 480 USD
101673-186 101673-184
T7 RNA Polymerase, Fermentas (Thermo Scientific)
Nucleic Acid Reagents RNA Synthesis and Transcription

T7 RNA polymerase is ideal for synthesis of unlabeled and labeled RNA. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.


  • Incorporates modified nucleotides (e.g., biotin-, digoxigenin-, fluorescently-labeled nucleotides)


This is also used in the study of RNA secondary structure and RNA-protein interactions, RNA splicing.


Consensus promoter sequence: TAATACGACTCACTATAGGGAGA


Información de suministro: Supplied with 1 mL of 5X Transcription Buffer.

Order Now


Learn more

About VWR

Avantor is a vertically integrated, global supplier of discovery-to-delivery solutions for...

Learn more About VWR